Download e-book for kindle: Beginning Perl for Bioinformatics by James Tisdall

By James Tisdall

ISBN-10: 0596000804

ISBN-13: 9780596000806

With its hugely built skill to become aware of styles in facts, Perl has turn into essentially the most well known languages for organic information research. but when you're a biologist with very little programming event, beginning out in Perl could be a problem. Beginning Perl for Bioinformatics is designed to get you quick over the Perl language barrier via forthcoming programming as a major new laboratory ability, revealing Perl courses and methods which are instantly priceless within the lab. each one bankruptcy makes a speciality of fixing a specific bioinformatics challenge or category of difficulties, beginning with the easiest and extending in complexity because the e-book progresses. each one bankruptcy comprises programming routines. by way of the tip of the publication you'll have a great knowing of Perl fundamentals, a suite of courses for such projects as parsing BLAST and GenBank, and the abilities to tackle extra complex bioinformatics programming.

Show description

Read or Download Beginning Perl for Bioinformatics PDF

Best bioinformatics books

New PDF release: Bioinformatics Sequence and Genome Analysis

As extra species' genomes are sequenced, computational research of those facts has turn into more and more vital. the second one, totally up to date variation of this generally praised textbook offers a accomplished and demanding exam of the computational equipment wanted for studying DNA, RNA, and protein information, in addition to genomes.

Download e-book for kindle: Cancer Proteomics: From Bench to Bedside (Cancer Drug by Sayed S. Daoud

This publication covers present subject matters with regards to using proteomic concepts in melanoma treatment in addition to expected demanding situations which can come up from its program in day-by-day perform. It info present applied sciences utilized in proteomics, examines the use proteomics in cellphone signaling, provides scientific purposes of proteomics in melanoma remedy, and appears on the function of the FDA in regulating using proteomics.

Download e-book for iPad: ACRI ’96: Proceedings of the Second Conference on Cellular by S. Bandini, G. Mauri (auth.)

ACRI'96 is the second one convention on mobile Automata for study and undefined; the 1st one was once held in Rende (Cosenza), on September 29-30, 1994. This moment variation confirms the growing to be curiosity in mobile Automata at present current either within the clinical neighborhood and in the commercial functions global.

Extra info for Beginning Perl for Bioinformatics

Example text

The substitution operator is an example of the use of regular expressions. Regular expressions are the key to text manipulation, one of the most powerful features of Perl as you'll see in later chapters. 5 Using the Perl Documentation A Perl programmer's most important resource is the Perl documentation. It should be installed on your computer, and it may also be found on the Internet at the Perl site. The Perl documentation may come in slightly different forms on your computer system, but the web version is the same for everybody.

The details of how to run a program depend on the type of computer you have (see Chapter 2). Let's say the program is on your computer in a file called example4-1. As you recall from Chapter 2, if you are running this program on Unix or Linux, you type the following in a shell window: perl example4-1 On a Mac, open the file with the MacPerl application and save it as a droplet, then just double-click on the droplet. On Windows, type the following in an MS-DOS command window: perl example4 -1 If you've successfully run the program, you'll see the output printed on your computer screen.

4] We're ignoring the mechanism of the splicing out of introns, obviously. The T stands for thymine; the U stands for uracil. IT-SC 51 Example 4-3. /usr/bin/perl -w # Transcribing DNA into RNA # The DNA $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; # Print the DNA onto the screen print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; # Transcribe the DNA to RNA by substituting all T's with U's. $RNA = $DNA; $RNA =~ s/T/U/g; # Print the RNA onto the screen print "Here is the result of transcribing the DNA to RNA:\n\n"; print "$RNA\n"; # Exit the program.

Download PDF sample

Beginning Perl for Bioinformatics by James Tisdall


by Anthony
4.3

Rated 4.52 of 5 – based on 34 votes